Accès membres

Mot de passe perdu? S'inscrire

11-04-2026 15:45

Zuzana Sochorová (Egertová) Zuzana Sochorová (Egertová)

Please, could anyone send me this paper?Moyne G.,

11-04-2026 13:34

Artem Ptukha

Hello, I am seeking assistance with the identific

11-04-2026 10:42

Castillo Joseba Castillo Joseba

Me mandan el material de Galicia, España, recolec

11-04-2026 10:19

Michel Hairaud Michel Hairaud

Chers amis d'Ascofrance , voici une très bonne no

11-04-2026 10:10

Michel Hairaud Michel Hairaud

Dear Ascofrance members, here is some very good ne

10-04-2026 23:22

Gernot Friebes

Hi,ascospores are 1- to 3-septate, approximately 

10-04-2026 15:51

William Slosse William Slosse

Hello everyone, On 08/04/26, I found a growth sit

09-04-2026 15:25

Jac Gelderblom

On bare soil between mosses Ifound an asco I deter

09-04-2026 13:55

Thomas Læssøe

https://svampe.databasen.org/observations/10589176

09-04-2026 10:12

Thomas Læssøe

https://svampe.databasen.org/observations/10587061

« < 1 2 3 4 5 > »
Pseudosclerococcum golindoi (det: Zotto)
Danny Newman, 15-12-2025 07:05
Danny NewmanPseudosclerococcum golindoi (det: Zotto)
near Cosby Campground, Great Smoky Mountains National Park, Cocke County, Tennessee, USA


Collected during the 2025 Richard P. Korf Memorial North American Ascomycete Foray (aka "The Korf Foray), held at the Appalachian Highlands Science Learning Center in Purchase Knob, North Carolina.


2x ITS sequences were generated from this material, one matching Orbilia dryadum, while the other is very close to Papillospora hebetiseta. both have thus far been considered to be "off-target," as in sequences of a fungus which is not the focus of the collection/observation in question.


only two spores were ever able to be observed outside of asci, as seen in the first micrograph (credit: Connor Dooley). otherwise, photo credits are as follows:


macro photography: Connor Dooley

micrographs: Patrick A Verdier


some comments on microscopy from Patrick:

"The hymenium was embedded in an extracellular gel with odd iodine staining, sometimes maroon (high iodine) sometimes teal (low iodine) suggesting a strange mix of amyloid/dextrinoid, with some carotenoids thrown in. Paraphyses swollen tips included a weird doughnut shaped structure, in fresh specimens at least. Paraphyses tips were also highly absorbent in blue light, and even more so in UV light (using a monochrome camera and UV light source)"



crossposted to the Ascomycetes of the World FB group at https://www.facebook.com/groups/ascomycetes/posts/4143399475912225
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
Hans-Otto Baral, 15-12-2025 08:40
Hans-Otto Baral
Re : indet. discomycete on wood (unk.)
Hi Danny

this should be Pseudosclerococcum golindoi. The spores in the type measured 10-12 x 4.5-5.5 and were 1-septate.

See paper Olariaga et al. , Mycological Progress (2019) 18:895–905
https://doi.org/10.1007/s11557-019-01500-7

Zotto
Danny Newman, 15-12-2025 09:11
Danny Newman
Re : indet. discomycete on wood (unk.)
thank you as always, Zotto.  I have added this genus and species to the nomenclatural database on iNat and credited you for the determination on the observation.  your expertise continues to be without equal.  the entire Korf Foray is grateful for your assistance.
Danny Newman, 15-12-2025 12:56
Danny Newman
Re : Pseudosclerococcum golindoi (det: Zotto)
one thing I've just noticed:

we generated two, inconclusive sequences from this material, as mentioned in the original post.

they are as follows:

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCAAACTGATAGATTCTTCTGCAGTGACGCCTTTGGAAGCCTTTGTGGCCCCGCAAGGGGTATTCACGGCGACTATAAACAAGAATGTGAGTATTAAATCGCAAGTCGGCCACCAGCGGCCGGCGACACTTTCGAATTGCGGGGAATCCCTAAAGCCCATCTCTACCAACCCGGCGCGGAAACGCGCGGGGGGCCGGTGCTAATCACACCGGGGCGGTAACAATGAGATGGGATAGACAGCATGGGCAATCCGCAGCCAAGTCCCTAAGGCGAGAGCTATGGGAAAGGTTCACAGACTAAGTGGAAGTGGGTTGGGGCCGGTGTGCCCCAGCTTAAGATATAGTCGGGCTTGATGAGAAATCGTCGGGGAGTCACTGGACTAAACATAAACTGTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAGAAAAGGCTTTGCGCCGGGCCCGTCCCGGACAGAGTTCAACCCTTTGTGAAAAACAACCTTCTTTTCGCTTCGGCAGCTCGCGCTCGCGCGGTCAGCCTGCCGGCAGCACCAAAAATATCAACCTGTCTCTGTAGATAATGTCTGACCATTCTGAATTGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCGTCGGCATTCCGACGGGCACGTCTGTCTGAGCGTCATGTCAAATCTCTGCTGGCCTGGGTTTGCGCCCGGTCAGCCGGTACTGAGCTGCGGTCTCCCAACCGGAACTGCGCTTTAAAGTGGCACGCTCTGCGGGTCTGACCGCTTCGAGAACATAGTATAATGCTATCTGTTCCAGGAGCCGGCTCAGGCAACCGCCTGAACAAATCTTCTATTAGGTTTGACCTCAGATCAGACGAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGGACTCGCAAGACTCCCTAAACCCTCGTGAACCTACCGAAACGTTGCCTCGGCGGGCGCCCGGCCTCTCGCGCCGGGCGCTGCGCCCGCCGGCGGCCCCCTACTCTGTCTCTGCAGCGTTGGCATCTCCGAGTATATACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCCACCCTCAGGCTCGGCCTGGTGTTGGGGGCCTGCCGCGCGCAGCCCCCGAAAGACAGCGGCGGTCCCGATCCCGGCTCCGAGCGTAGTAATACACGTCGCTCTGGGCGCCTGGCGGGCTTCCAGCCGGAAACCTCACATATCAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

they bear a 90-92% similarity to the GenBank accession for the ITS sequence of the type of P. golindoi (https://www.ncbi.nlm.nih.gov/nuccore/MK759885.1).

I wonder, Zotto, if you could comment on the accuracy/usefulness of either of these sequences.  I was expecting them to be much more dissimilar to MK759885.1 if they truly belonged to contaminants.  Perhaps one of them is "good," and this is merely evidence of significant variation in ITS sequences in this taxon?
Hans-Otto Baral, 15-12-2025 15:24
Hans-Otto Baral
Re : Pseudosclerococcum golindoi (det: Zotto)
How I do it: Search for ATCATTA and TGACCT and copy the part between (wihich is ITS and 5.8S) into GenBank Blast search. 

The first sequence gives 99.6% Orbilia dryadum. So this is clearly this Orbilia species.

The second gives with 98.5% Papillospora henetiseta (Chaetosphaeriaceae).

In the alignment of Sclerococcales I saw at once that it is something different.