Accès membres

Mot de passe perdu? S'inscrire

20-03-2026 12:53

Stefan Blaser

Hello everybody, In the field, from distance, my

20-10-2017 09:23

Garcia Susana

Este otro crecía en el mismo trocito de madera qu

20-03-2026 16:16

Edvin Johannesen Edvin Johannesen

These 0.5 mm diam. acervuli were breaking through

19-03-2026 19:34

Filip Fuljer Filip Fuljer

Hello everyone,a few days ago I collected this str

19-03-2026 18:25

William Slosse William Slosse

Good evening everyone, On 18/03/26 I found a few

17-03-2026 10:09

François Freléchoux François Freléchoux

Bonjour, Voici la description rapide d'un petit d

19-03-2026 15:58

Stefan Blaser

Hello everybody, I hope for some hints... Macro:

19-03-2026 17:50

Enrique Rubio Enrique Rubio

Hi to everybodyThese thiny, blackish pseudothecia

18-03-2026 13:09

Khomenko Igor Khomenko Igor

I recently examined Celtis occidentalis branches

17-03-2026 19:41

Bernard CLESSE Bernard CLESSE

Bonsoir à toutes et tous,Pourriez-vous m'aider à

« < 1 2 3 4 5 > »
Pseudosclerococcum golindoi (det: Zotto)
Danny Newman, 15-12-2025 07:05
Danny NewmanPseudosclerococcum golindoi (det: Zotto)
near Cosby Campground, Great Smoky Mountains National Park, Cocke County, Tennessee, USA


Collected during the 2025 Richard P. Korf Memorial North American Ascomycete Foray (aka "The Korf Foray), held at the Appalachian Highlands Science Learning Center in Purchase Knob, North Carolina.


2x ITS sequences were generated from this material, one matching Orbilia dryadum, while the other is very close to Papillospora hebetiseta. both have thus far been considered to be "off-target," as in sequences of a fungus which is not the focus of the collection/observation in question.


only two spores were ever able to be observed outside of asci, as seen in the first micrograph (credit: Connor Dooley). otherwise, photo credits are as follows:


macro photography: Connor Dooley

micrographs: Patrick A Verdier


some comments on microscopy from Patrick:

"The hymenium was embedded in an extracellular gel with odd iodine staining, sometimes maroon (high iodine) sometimes teal (low iodine) suggesting a strange mix of amyloid/dextrinoid, with some carotenoids thrown in. Paraphyses swollen tips included a weird doughnut shaped structure, in fresh specimens at least. Paraphyses tips were also highly absorbent in blue light, and even more so in UV light (using a monochrome camera and UV light source)"



crossposted to the Ascomycetes of the World FB group at https://www.facebook.com/groups/ascomycetes/posts/4143399475912225
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
Hans-Otto Baral, 15-12-2025 08:40
Hans-Otto Baral
Re : indet. discomycete on wood (unk.)
Hi Danny

this should be Pseudosclerococcum golindoi. The spores in the type measured 10-12 x 4.5-5.5 and were 1-septate.

See paper Olariaga et al. , Mycological Progress (2019) 18:895–905
https://doi.org/10.1007/s11557-019-01500-7

Zotto
Danny Newman, 15-12-2025 09:11
Danny Newman
Re : indet. discomycete on wood (unk.)
thank you as always, Zotto.  I have added this genus and species to the nomenclatural database on iNat and credited you for the determination on the observation.  your expertise continues to be without equal.  the entire Korf Foray is grateful for your assistance.
Danny Newman, 15-12-2025 12:56
Danny Newman
Re : Pseudosclerococcum golindoi (det: Zotto)
one thing I've just noticed:

we generated two, inconclusive sequences from this material, as mentioned in the original post.

they are as follows:

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCAAACTGATAGATTCTTCTGCAGTGACGCCTTTGGAAGCCTTTGTGGCCCCGCAAGGGGTATTCACGGCGACTATAAACAAGAATGTGAGTATTAAATCGCAAGTCGGCCACCAGCGGCCGGCGACACTTTCGAATTGCGGGGAATCCCTAAAGCCCATCTCTACCAACCCGGCGCGGAAACGCGCGGGGGGCCGGTGCTAATCACACCGGGGCGGTAACAATGAGATGGGATAGACAGCATGGGCAATCCGCAGCCAAGTCCCTAAGGCGAGAGCTATGGGAAAGGTTCACAGACTAAGTGGAAGTGGGTTGGGGCCGGTGTGCCCCAGCTTAAGATATAGTCGGGCTTGATGAGAAATCGTCGGGGAGTCACTGGACTAAACATAAACTGTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAGAAAAGGCTTTGCGCCGGGCCCGTCCCGGACAGAGTTCAACCCTTTGTGAAAAACAACCTTCTTTTCGCTTCGGCAGCTCGCGCTCGCGCGGTCAGCCTGCCGGCAGCACCAAAAATATCAACCTGTCTCTGTAGATAATGTCTGACCATTCTGAATTGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCGTCGGCATTCCGACGGGCACGTCTGTCTGAGCGTCATGTCAAATCTCTGCTGGCCTGGGTTTGCGCCCGGTCAGCCGGTACTGAGCTGCGGTCTCCCAACCGGAACTGCGCTTTAAAGTGGCACGCTCTGCGGGTCTGACCGCTTCGAGAACATAGTATAATGCTATCTGTTCCAGGAGCCGGCTCAGGCAACCGCCTGAACAAATCTTCTATTAGGTTTGACCTCAGATCAGACGAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGGACTCGCAAGACTCCCTAAACCCTCGTGAACCTACCGAAACGTTGCCTCGGCGGGCGCCCGGCCTCTCGCGCCGGGCGCTGCGCCCGCCGGCGGCCCCCTACTCTGTCTCTGCAGCGTTGGCATCTCCGAGTATATACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCCACCCTCAGGCTCGGCCTGGTGTTGGGGGCCTGCCGCGCGCAGCCCCCGAAAGACAGCGGCGGTCCCGATCCCGGCTCCGAGCGTAGTAATACACGTCGCTCTGGGCGCCTGGCGGGCTTCCAGCCGGAAACCTCACATATCAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

they bear a 90-92% similarity to the GenBank accession for the ITS sequence of the type of P. golindoi (https://www.ncbi.nlm.nih.gov/nuccore/MK759885.1).

I wonder, Zotto, if you could comment on the accuracy/usefulness of either of these sequences.  I was expecting them to be much more dissimilar to MK759885.1 if they truly belonged to contaminants.  Perhaps one of them is "good," and this is merely evidence of significant variation in ITS sequences in this taxon?
Hans-Otto Baral, 15-12-2025 15:24
Hans-Otto Baral
Re : Pseudosclerococcum golindoi (det: Zotto)
How I do it: Search for ATCATTA and TGACCT and copy the part between (wihich is ITS and 5.8S) into GenBank Blast search. 

The first sequence gives 99.6% Orbilia dryadum. So this is clearly this Orbilia species.

The second gives with 98.5% Papillospora henetiseta (Chaetosphaeriaceae).

In the alignment of Sclerococcales I saw at once that it is something different.