07-02-2023 22:28
Ethan CrensonHello friends, On Sunday, in the southern part of
19-02-2026 13:50
Margot en Geert VullingsWe found this collection on deciduous wood on 7-2-
16-02-2026 21:25
Andreas Millinger
Good evening,failed to find an idea for this fungu
08-12-2025 17:37
Lothar Krieglsteiner
20.6.25, on branch of Abies infected and thickened
17-02-2026 17:26
Nicolas Suberbielle
Bonjour à tous, Je recherche cette publication :
15-02-2026 04:32
One more specimen that is giving me some descent a
17-02-2026 13:41
Isabelle CharissouBonjour, est-ce que quelqu'un pourrait me fournir
this fungus is unknown to me, likely American, but I think you are close to the solution.
I went through 2010 Mugambi & Huhndorf's paper (Mycologia 102: 185-210) dealing with the phylogeny of Coronophorales and I learnt that F. callista has been moved to Neofracchieae callista, characterised by a brown subiculum, as on your photos.
I should display a quellkorper, visible in section or with some luck in a squash mount, which places it outside Nitschkiaceae in a distant family. Awful name, I don't even try to memorise it.
I could not find more information on this taxon, maybe Andy can help.
Cheers,
Jacques
Good luck
Jacques
I was never able to find a quellkörper after a few decent tries, so I decided to sequence this collection. I got what I believe is a decent ITS (below), but when I blast it, it does not match the one sequence of Neofracchiaea callista uploaded to GenBank by Huhndorf, Miller and Fernandez (AY695269).
The closest match is a distant 85.83% similarity to Yuxiensis granularis, which is in Scortechiniaceae (Coronophorales) and does bear a quellkörper.
I would not be surprised if my inability to find the quellkörper was due to my mediocre microscopy, inexperience, or not having a microtome. But I'm not certain.
Any ideas on this? I'd be very grateful for any at all.
Thanks!
ACAGAGTGCCCATGGCTCTGCCAACCCTGCGAACCTTACCATGTTGCCTCGGCGGCCTCAACCGCCGCAG
GCCCATCATACTCTTTTTATTACTATCGTCCCTCTGACTAAAACTTTTAATAAGTAAAAACTTTCAACAA
CGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTC
AGTGAACCATCGAGTCTTTGAACGCACATTGCGGCTGCCGGCATTCCGGCGGCCATGCCTGTCCGAGCGC
CACTAACACCCTCAGAGCCTAGTTTCTGGCGTTGGGTAACTGCCTCAGCGGCGGTCGCCTCAAAGTTAGT
GGCGGCGGCGCCCGTGGTGCGACGTACTCAGTAAAATTGCTAGCACGAAGCCCCGGCGCTCGCCTGCCGC
GAGAACCCCTCCATTTTAAAGTGGTTGGCCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATA









