02-01-2026 17:43
MARICEL PATINOHi there, although I couldn't see the fruitbody, I
04-01-2026 17:45
Stephen Martin Mifsud
I was happy to find these orange asmocyetes which
03-01-2026 13:08
Niek SchrierHi all,We found groups of perithecia on a Lecanora
29-12-2025 17:44
Isabelle CharissouBonjour,J'aimerais savoir si d'autres personnes au
01-01-2026 18:35
Spooren Marco
Original loamy soil aside a artificial lake.The co
31-12-2025 19:27
Spooren Marco
Collected from loamy soil, at waterside (completel
Asco on Carex nigra
Simon Gurtner,
22-12-2024 10:19
Hello,can anyone help me identify this small ascomycete?
Found on 01.08.2024 in the Swiss Alps at 2220 m above sea level on Carex nigra.
So far, I have not been able to determine even the genus. Allophylaria is one idea. However, this could not be confirmed by sequencing.
I wish everyone a Merry Christmas and a Happy New Year.
Best regards,
Simon
Here is the sequencing:
AAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGCTCATGCCCCCCGGGGTAGAACTCCACCCTTGCTTGTGCTACCTAGTTGCTTTGGCAGGCCGCTGGCCTACCGTGCCGTGCCTGCCAGAGGTTCTAAACTCGTGTCTCTGAAATCGTCTGAGTAAT ACAAAATTGAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTAGGTATTCCTGGGGGCATGCCTGTCCGAGCGTCATTAAACACCACTCA AGCTCCGCTTGGTCCTGGGGCGCGCTAGATTTCTAGCGCTCCCTAAACTCAGTGGCGGCGGCTCTCGACCCTCCAGCGCAGTATAACACCTCGCTATGAGATCGGGATCCGCTGGCCAGCAAGCACTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA
Lothar Krieglsteiner,
22-12-2024 10:22
Re : Asco on Carex nigra
why not a Cyathicula? Sometimes it helps to have spores, the reaction of the ascus apex with IKI and some further details.
Simon Gurtner,
22-12-2024 10:35
Re : Asco on Carex nigra
Hi Lothar, when I created the thread, I uploaded the data before I was finished. I have added the missing images. Cyathicula was my first thought macroscopically. However, the microscopy does not fit.
Lothar Krieglsteiner,
22-12-2024 10:45
Re : Asco on Carex nigra
Hello Simon,
ah - I was too fast. Now I see spores - but still not the ascus-apes in IKI. In Allophylaria it ist often (not always) reacting hemiamyloid.
What I already saw are guttulate (dying?) paraphyses what fits for Cyathicula - and for Hymenoscyphus. The excipulum seems more a prismatica than oblita, so o.k. better a Hymenoscyphus. The spores would fit here also better.
Yours, Lothar
ah - I was too fast. Now I see spores - but still not the ascus-apes in IKI. In Allophylaria it ist often (not always) reacting hemiamyloid.
What I already saw are guttulate (dying?) paraphyses what fits for Cyathicula - and for Hymenoscyphus. The excipulum seems more a prismatica than oblita, so o.k. better a Hymenoscyphus. The spores would fit here also better.
Yours, Lothar
Stip Helleman,
22-12-2024 12:51
Re : Asco on Carex nigra
Hi Simon,
to me it looks also as a Cyathicula/Hymenoscyphus, only the sequence does not make any sense. There is no attachment to Helotiaceae in the Multiple sequence ML tree.
Herzliche Gruessen, Frohe Weihnachten und ein gute Rutsch
Stip
Simon Gurtner,
22-12-2024 15:34
Re : Asco on Carex nigra
Hallo Lothar, Hallo Stipe
Danke für eure Hilfe. Zu Beginn habe ich in der Ecke gesucht, bin aber auf kein Ergebniss gekommen. Ich werde es noch einmal da versuchen. Die Sequenz verwirrt mich mehr als es mir hilft.
Grüsse, Simon
Danke für eure Hilfe. Zu Beginn habe ich in der Ecke gesucht, bin aber auf kein Ergebniss gekommen. Ich werde es noch einmal da versuchen. Die Sequenz verwirrt mich mehr als es mir hilft.
Grüsse, Simon
Hans-Otto Baral,
22-12-2024 16:23
Re : Asco on Carex nigra
My guess was Cyathicula macrospora, and I remember a negative IKI reaction of the asci. I think the sequence is a contamination.
Simon Gurtner,
22-12-2024 17:55
Re : Asco on Carex nigra
Hallo Zotto,
unter Cyathicula macrospora kann ich nichts finden. Meinst du Allophylaria macrospora?
Grüsse, Simon
unter Cyathicula macrospora kann ich nichts finden. Meinst du Allophylaria macrospora?
Grüsse, Simon
Simon Gurtner,
22-12-2024 18:35
Re : Asco on Carex nigra
... oder Cythicula megalospora? da hänge ich gerade im Schlüssel
Hans-Otto Baral,
22-12-2024 18:40
Re : Asco on Carex nigra
Sorry, ja, megalospora
Simon Gurtner,
22-12-2024 19:04
Re : Asco on Carex nigra
Vielen Dank euch allen :)