23-11-2025 11:16
Bohan JiaHi, I found small discs growing on dead stem of
21-11-2025 10:56
Christopher Engelhardt
Very small (~0,5 mm) white ascos, found yesterday
21-11-2025 11:52
Jean-Luc RangerBonjour à tous, on voit toujours 2 espèces areni
14-11-2025 16:26
Marian Jagers
Hello everyone, On dead wood of Cytisus scoparius
17-11-2025 21:46
Philippe PELLICIERBonjour,Récolté sur bois pourrissant de feuillu
Asco from Mexico, with ITS sequence
Alan Rockefeller,
15-05-2016 02:06
Hi - I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is?
I could also do LSU sequences....
The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
Christian Lechat,
15-05-2016 08:09
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf
Michel Hairaud,
15-05-2016 08:56
Re : Asco from Mexico, with ITS sequence
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
Hans-Otto Baral,
15-05-2016 09:28
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto