Accès membres

Mot de passe perdu? S'inscrire

11-05-2026 12:32

Bernard CLESSE Bernard CLESSE

Pourriez-vous m'aider à identifier cette héloti

13-05-2026 15:26

François Freléchoux François Freléchoux

Bonjour,Voici une récolte faite il y a quelques j

12-05-2026 15:41

Nicolas VAN VOOREN Nicolas VAN VOOREN

Dear Ascolovers, especially interested in Pezizale

13-05-2026 12:05

Thierry Blondelle Thierry Blondelle

Bonjour à tous,J'aimerais avoir confirmation de c

10-05-2026 23:17

Andreas Gminder Andreas Gminder

Hello,today we found in a moist steep decidous for

28-04-2026 20:07

Lothar Krieglsteiner Lothar Krieglsteiner

... on twig in the air at standing Ceratonia siliq

27-04-2026 20:52

Lothar Krieglsteiner Lothar Krieglsteiner

Found on hanging tiwg of Olea europaea in dried-ou

11-05-2026 20:22

Lothar Krieglsteiner Lothar Krieglsteiner

on attached twig of standing Ficus caricaquite uns

11-05-2026 13:22

Sylvie Le Goff

BonjourPuis avoir votre avis sur cet ascome, je vo

29-04-2026 10:44

Lothar Krieglsteiner Lothar Krieglsteiner

growing at moist, drying-out soil at the side of a

« < 1 2 3 4 5 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto