Accès membres

Mot de passe perdu? S'inscrire

12-03-2026 19:44

Enrique Rubio Enrique Rubio

Hi to everybody.Can you give me any suggestions ab

11-03-2026 17:36

Michel Hairaud Michel Hairaud

Bonjour, Je cherche des indices  pour cette réc

12-03-2026 15:45

Åge Oterhals

Dear forum,I found this small discomycete on a ver

05-03-2026 10:07

Hulda Caroline Holte

Hello, I found and collected this species growing

08-03-2026 14:05

Thierry Blondelle Thierry Blondelle

Bonjour à tous,Sur 3 récoltes supposées de H. l

12-03-2026 16:17

Sylvie Le Goff

Bonjour à tousRécolté dans le 22 en France (ré

12-03-2026 14:37

David Wasilewski

These small ascomycota (1-3 mm) ere observed growi

11-03-2026 16:48

Bruno Coué Bruno Coué

Bonjour, je serais heureux d'avoir votre avis sur

09-02-2026 22:01

ruiz Jose

Hola, me paso esta colección en madera de pino, t

11-03-2026 14:14

Gernot Friebes

Hi,I would like to share a collection of Scopinell

« < 1 2 3 4 5 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto