16-02-2026 18:34
Thierry Blondelle
Bonjour,La micro de cet anamorphe de Hercospora su
08-12-2025 17:37
Lothar Krieglsteiner
20.6.25, on branch of Abies infected and thickened
16-02-2026 21:25
Andreas Millinger
Good evening,failed to find an idea for this fungu
16-02-2026 17:14
Joanne TaylorLast week we published the following paper where w
16-02-2026 16:53
Isabelle CharissouBonjour, quelqu'un pourrait-il me transmettre un
16-02-2026 11:53
Joeri Belisbetween leaf litter on twig in young salix growth.
14-02-2026 22:45
Tomaz Vucko
Hy!I would ask for some help determing this specie
13-02-2026 03:30
Tomaz Vucko
Hello! I found these immersed perithecia on a stic
Hi - I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is?
I could also do LSU sequences....
The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto