30-11-2025 12:53
Edvin Johannesen
White short-stipitate apothecia found on thin twig
30-11-2025 10:47
William Slosse
I recently found a collection of small Peziza sp.
27-11-2025 12:01
Thomas Læssøehttps://svampe.databasen.org/observations/10496727
27-11-2025 11:46
Thomas Læssøehttps://svampe.databasen.org/observations/10493918
17-09-2025 10:50
Heather MerryleesHi there!I am hoping for any advice on the identif
29-11-2025 08:40
Andreas Millinger
Hello,on a splintered part of a branch on the grou
28-11-2025 16:45
Nogueira HéctorNovember 23, 2025 Requejo de Sanabria (León) SPAI
25-11-2025 14:24
Thomas Læssøehttps://svampe.databasen.org/observations/10490522
27-11-2025 15:41
Thomas LæssøeSpores brownish, typically 4-celled; 26.8 x 2.4;
27-11-2025 11:31
Thomas LæssøeCollectors notes: Immersed ascomata, erumpent thro
Hi - I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is?
I could also do LSU sequences....
The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto