Accès membres

Mot de passe perdu? S'inscrire

01-02-2026 19:29

Nicolas Suberbielle Nicolas Suberbielle

Bonjour, Marie-Rose D'Angelo (Société Mycologiq

30-01-2026 22:49

éric ROMERO éric ROMERO

Bonjour tous, Récolté dans les Vosges le 22/10/

31-01-2026 09:17

Marc Detollenaere Marc Detollenaere

Dear Forum,On decorticated wood of Castanea,I foun

29-08-2025 05:16

Francois Guay Francois Guay

I think I may have found the teleomorph of Dendros

31-01-2026 10:22

Michel Hairaud Michel Hairaud

Bonjour, Cette hypocreale parasite en nombre les

30-01-2026 21:20

Arnold Büschlen

Bryocentria brongniartii und B. metzgeriae mit ihr

21-01-2026 16:32

Gernot Friebes

Hi,I need your help with some black dots on a lich

07-12-2015 14:17

Zugna Marino Zugna Marino

Buon giorno a tutti, ad un primo momento, non ess

29-01-2026 10:04

Jean-Paul Priou Jean-Paul Priou

Bonjour à tous, Marcel LECOMTE président de L'A

17-11-2009 22:22

Pablo Chacón Pablo Chacón

Bonne nuit, Voir si vous m'avez élaguée appor

« < 1 2 3 4 5 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto