Accès membres

Mot de passe perdu? S'inscrire

22-04-2012 19:03

Yannick Mourgues Yannick Mourgues

Bonsoir.Voilà un truc qui ne me dit absolument ri

21-04-2012 15:31

Luc Bailly Luc Bailly

Bonjour à tous,Provenance: Château féodal de Mo

22-04-2012 13:29

Yannick Mourgues Yannick Mourgues

On dit que dans le genre Ophiobolus ont été plac

29-12-2008 07:38

Alain GARDIENNET Alain GARDIENNET

Bonjour, Un asco noir immergé sous l'épiderme

21-04-2012 12:17

Guy Garcia

Bonjour à tous,Je recherche trois vieilles publ

20-04-2012 16:40

Stefan Blaser

Hello everybodyI have a collection of Nitschkia on

21-04-2012 15:07

Luc Bailly Luc Bailly

Bonjour à tous,Quelques récoltes récentes.Prove

21-04-2012 15:46

Luc Bailly Luc Bailly

Bonjour à tous,Provenance: Château féodal de Mo

19-04-2012 20:37

Enrique Rubio Enrique Rubio

Hi againDo you know this bitunicate ascomycete wit

20-04-2012 09:52

François Valade François Valade

HelloI am looking for this paper to check if there

« < 1328 1329 1330 1331 1332 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto