11-02-2026 19:28
Lothar Krieglsteiner
on small deciduous twig on the ground in forest wi
25-04-2025 17:24
Stefan BlaserHi everybody, This collection was collected by JÃ
11-02-2026 22:15
William Slosse
Today, February 11, 2026, we found the following R
10-02-2026 17:42
Bernard CLESSE
Bonjour à toutes et tous,Pourriez-vous me donner
10-02-2026 18:54
Erik Van DijkDoes anyone has an idea what fungus species this m
09-02-2026 20:10
Lothar Krieglsteiner
The first 6 tables show surely one species with 2
09-02-2026 14:46
Anna KlosGoedemiddag, Op donderdag 5 februari vonden we ti
02-02-2026 21:46
Margot en Geert VullingsOn a barkless poplar branch, we found hairy discs
Hi -Â I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. Â Â I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Â Â Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is? Â
I could also do LSU sequences....
 The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto