Accès membres

Mot de passe perdu? S'inscrire

30-05-2026 21:12

Philippe PELLICIER

Sur branche de mélèze (Larix) près de la neige,

31-05-2026 10:35

Hulda Caroline Holte

Hello,I collected this species growing on a rather

25-05-2026 16:35

Bernard CLESSE Bernard CLESSE

Bonjour à toutes et tous,J'ai trouvé récemment,

29-05-2026 15:35

daniel FERRE

Bonjour à tous,Je voudrais votre aide pour cette

28-05-2026 16:15

James Mitchell

Hello,Does anyone have the original publication of

28-05-2026 11:06

Thomas Læssøe

https://svampe.databasen.org/observations/10596750

23-05-2026 11:44

Charles Grapinet Charles Grapinet

Hello, I am having trouble identifying this copro

25-05-2026 16:44

François Bartholomeeusen

Hi forum members,During an excursion organised by

26-05-2026 21:25

Dirk Gerstner

Hello everyone, I'm completely stumped by this li

26-05-2026 22:44

Ethan Crenson

Hi all, I think I have Incrucipulum capitatum her

« < 1 2 3 4 5 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto