Accès membres

Mot de passe perdu? S'inscrire

22-04-2026 20:54

Enrique Rubio Enrique Rubio

Hi to everybody.This Pyrenopeziza grew in moist le

25-04-2026 11:34

Louis DENY

Bonjour forumdans la clé de Zotto, L. pudicellum

24-04-2026 03:16

David Chapados David Chapados

Found while looking at something else from wood in

22-04-2026 01:06

Richard VALERI Richard VALERI

Bonjour à tous.Je vous présente cette Nectria s.

22-04-2026 20:17

Marian Jagers Marian Jagers

Is anyone familiar with the Hyphomycetes genus Pse

23-04-2026 06:46

François Freléchoux François Freléchoux

Bonjour, Voici la description d'un minuscule asco

21-04-2026 22:14

Margot en Geert Vullings

This cup fungus was found on April 10, 2026, on lo

22-04-2026 19:12

Louis DENY

Bonjour forum.Trouvé à Belfort, est de la France

21-04-2026 21:00

Sylvie Le Goff

Bonjour à tousJe sollicite votre aide pour cet as

21-04-2026 13:36

Gernot Friebes

Hi,I am out of ideas for this one. I collected Sal

« < 1 2 3 4 5 > »
Asco from Mexico, with ITS sequence
Alan Rockefeller, 15-05-2016 02:06
Alan RockefellerHi - 

I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico.    I haven't done any microscopy yet, but I can.

I was surprised to see that there were no close matches.    Can anyone turn this ITS sequence into useful information?

Or will I have to do the micro work to figure out what this is?  

I could also do LSU sequences....

 The ITS sequence is:

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

  • message #42693
Christian Lechat, 15-05-2016 08:09
Christian Lechat
Re : Asco from Mexico, with ITS sequence
Hi Alan,
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.

Regards,
Christian
Michel Hairaud, 15-05-2016 08:56
Michel Hairaud
Re : Asco from Mexico, with ITS sequence

Bonjour Alan,


The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...


Amitiés


Michel

Hans-Otto Baral, 15-05-2016 09:28
Hans-Otto Baral
Re : Asco from Mexico, with ITS sequence
I also recommend to make a brief microscopic analysis, so that we know if they are apothecia on the photo or something anamorphic.

If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.

In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.

Zotto