12-04-2026 17:56
Hardware Tony
Found on dead stems in February earlier this year
17-04-2026 19:16
Enrique Rubio
Hi to everybodyI would appreciate any assistance r
14-04-2026 05:32
Ethan CrensonHi all, A few weeks back a friend pointed out som
17-04-2026 15:14
Bruno Coué
Bonjour.Récoltes du 16/04/2026, sur feuilles mort
12-04-2026 15:52
Gernot FriebesHi,I'm looking for help with this anamorph collect
14-04-2026 21:52
Gernot FriebesHi,found on dead leaves of Carex elata. Conidia: 4
16-04-2026 22:09
Buckwheat PeteHello, I'd like to ask about this older specimen:
15-04-2026 19:33
Fátima Durán ManzanequeHi!! I need help, I found this Ascomycete but I d
14-04-2026 20:31
Gernot FriebesHi,can this be Psilachnum lateritioalbum on Phragm
12-04-2026 12:22
William Slosse
In a dune grassland in Oostduinkerke (Belgium), on
Hi - I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is?
I could also do LSU sequences....
The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto