Accès membres

Mot de passe perdu? S'inscrire

05-02-2026 15:07

Vasileios Kaounas Vasileios Kaounas

Found on a fallen needle of Pinus halepensis, diam

05-02-2026 06:43

Stefan Blaser

Hello everybody, Any help on this one would be mu

18-08-2025 15:07

Lothar Krieglsteiner Lothar Krieglsteiner

.. 20.7.25, in subarctic habital. The liverwort i

02-02-2026 21:46

Margot en Geert Vullings

On a barkless poplar branch, we found hairy discs

02-02-2026 14:55

Andgelo Mombert Andgelo Mombert

Bonjour,Sur thalle de Lobaria pulmonaria.Conidiome

02-02-2026 14:33

Andgelo Mombert Andgelo Mombert

Bonjour,Sur le thalle de Peltigera praetextata, ne

31-01-2026 10:22

Michel Hairaud Michel Hairaud

Bonjour, Cette hypocreale parasite en nombre les

02-02-2026 09:29

Bernard CLESSE Bernard CLESSE

Bonjour à toutes et tous,Pour cette récolte de 2

01-02-2026 19:29

Nicolas Suberbielle Nicolas Suberbielle

Bonjour, Marie-Rose D'Angelo (Société Mycologiq

30-01-2026 22:49

éric ROMERO éric ROMERO

Bonjour tous, Récolté dans les Vosges le 22/10/

« < 1 2 3 4 5 > »
coprophilous Scutellinia
Warre Van Caenegem, 14-03-2025 23:29
Good evening everyone. Last year, I found this coprophilous Scutellinia species on bovine dung, near an acidic fen on sandy soil. I generated an ITS sequence, but I found no matches on Genbank, neither I found any morphological match. Could you perhaps help me to identify this collection?

Apothecia up to 5 mm
Hairs mostly bi- or trifurcated, sometimes simple, up to 600 µm, mostly between 300 and 500 µm, septated, the top of the hairs are hyaline,
Asci 205-240 x (12-)15-16 µm, 8-spored
Ascospores (16-)17-19(-20) x 10-12 µm, with regular spaced, low wrats
Found in Belgium, Antwerp, Mol, on 10 April 2024.

ITS has been sequenced, and matches 97,7% with Scutellinia sp. (Genbank Accession numbers MW540903.1 en MW540937.1), and 96,9% with S. fimicola (MW540964.1). The morphology does not match with S. fimicola, because of the smaller spores and the larger asci.

Are there any other fimicolous Scutellinia species known?

>Scutellinia_ITS
ACCCATCTGCGTACATTACCCGTTGCTTCCGCGAGGCAGTGATCTTCGATCACCTC
CCGACGATGGCTTGGGCCNTCCGGTGGGGAGCCCTCGTGAAAGGTTTACACCAA
ACCCTTGCATTTCTATGTCATCTGTCTGAAACTGTTAATAACAAATGTWAAAACTTT
CAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA
GTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGAACATTGCGCC
TCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAATACCACACTCGAGT
CATTTTCGTGGCTCGGTCTTGGGAGAGGAGCGCAACTCGTCTGCCCTCCCTTCCG
AAATCCAATGGCGGAAAGCCCCACGTGCCCCGGCGTAGTAAGTCTTCTTTCGCTC
GGAACGTTTGGCGATCCTGCCGTGAACCCCCCACAAAATCATTTTACAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
Malcolm Greaves, 15-03-2025 10:04
Malcolm  Greaves
Re : coprophilous Scutellinia
In the UK we have had at least 4 species which have been found on dung. Unfortunately none fit your specimen but it shows that at least some of the soil inhabiting species can also grow on dung.
Lothar Krieglsteiner, 15-03-2025 12:08
Lothar Krieglsteiner
Re : coprophilous Scutellinia
my hyperborea/minor from the Alps that I want to re-examine soon was growing on cow dung, too.
I was surprised that it was definitely a Scutellinia and not a Cheilymenia.