Accès membres

Mot de passe perdu? S'inscrire

17-01-2026 19:35

Cosmospora aurantiicola: Gibt es dazu Literatur ?
Arnold Büschlen

Hallo, ich suche zu Cosmospora aurantiicola Lite

17-01-2026 10:41

Pulvinula
Blasco Rafael Blasco Rafael

Hola, he descubierto que he creado una Pulvinula t

08-12-2025 17:37

possibly related to Melanomma - on Abies
Lothar Krieglsteiner Lothar Krieglsteiner

20.6.25, on branch of Abies infected and thickened

16-01-2026 00:45

Hyphodiscus (?) on hardwood, hemiamyloid, staining reddish-orange
Ethan Crenson

Hi all, On decorticated hardwood from a New York

16-01-2026 11:20

Una para ID
Castillo Joseba Castillo Joseba

Me mandan el material seco de Galicia (España) 

10-01-2026 20:00

Lichenicolous fungus on Protoparmeliopsis muralis
Tom Schrier

Hi all,We found picnidia on Protoparmeliopsis mur

13-01-2026 07:28

Chlorociboria glauca on indet. decorticate hardwood log - 303627368
Danny Newman Danny Newman

Chlorociboria glauca on indet. decorticate logThe

15-01-2026 15:55

pyrenomycete on Quercus
Lothar Krieglsteiner Lothar Krieglsteiner

this one is especially interesting for me because

15-01-2026 10:35

Hyphomycete ?
Johan Boonefaes Johan Boonefaes

Last week I found this fungus, possibly a hyphomyc

13-01-2026 08:43

Tricladium varicosporioides on indet. decorticate stick - 303997395
Danny Newman Danny Newman

Tricladium varicosporioides on indet. decorticate

« < 1 2 3 4 5 > »
Durella
Ethan Crenson, 24-03-2022 20:43
As long as we are discussing Durella...!  I have found this Durella in New York City on several occasions.  It seems to grow on bare hardwood. I found it again last weekend in the Bronx, so the images and data are from that collection.

Apothecia are up to 1mm in diameter, brownish black, roughened and with a raised margin when dry. Cushion shaped when hydrated.


Spores (from spore drop) are hyaline, mostly 3-septate, some 4-septate, fusiform and some are a bit irregular shaped. Some spores are shorter, wider and tear-drop shaped.  Oil droplets are present.  They measure 14.7 - 27.9 (35.6) x 3.5-5.4µm.


Asci 68-87 x 8-11.1µm, no croziers, IKI-


Paraphyses branched, septate, brown at the ends and swollen up to 4-5µm wide.


In Zotto's folder for Durella, this seems to match "Durella macrospora IKI-". The spores in my collection are somewhat longer.  But I notice that they are similar in that the spores are quite irregularly shaped and some are quite small and tear drop shaped. 


Thanks,


Ethan

  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
Piotr Perz, 24-03-2022 20:58
Re : Durella
Are you sure about the croziers (image interpretation)?
IMO looks like CRZ+
Ethan Crenson, 24-03-2022 21:03
Re : Durella
(sigh) I'm often wrong about croziers.
Hans-Otto Baral, 24-03-2022 21:23
Hans-Otto Baral
Re : Durella
My first idea was also macrospora, but there the paraphysis tips do not carry browmn exudate and possess hyaline refractive resinous matter in the hymenium.

Patellariopsis clavispora is excluded by having a deep blue apical ring and globular excipular cells. I assume your sample has brown porrecta (please check).
Piotr Perz, 24-03-2022 21:24
Re : Durella
Try with young apothecium and very immature ascii.
Ethan Crenson, 26-03-2022 21:08
Re : Durella
Hello and thanks to you both.  First, yes, I missed the presence of croziers.  I include here a better photo.  As far as the exudate surrounding the paraphyses tips, I can't say for certain.  There is material there, but it doesn't look as if it is the same material which makes the paraphyses tips  brown. I have attempted to show the excipulum with textura porrecta.

There is a sequence of a collection very similar to this Durella (mislabeled D. melanochlora) which I found in a park in Staten Island (other end of the city) in 2019. Here is a link to the observation. The sequence is further down the page on the right. It blasts very close to another sequence that is labeled D. macrospora from the Boston Harbor Islands survey (Haelewaters,D., Dirks,A.C., Kappler,L.A., Mitchell,J.K., Quijada,L., Vandegrift,R., Buyck,B. and Pfister,D.H.)

Again, thanks!
  • message #72263
  • message #72263
  • message #72263
  • message #72263
  • message #72263
Hans-Otto Baral, 26-03-2022 21:24
Hans-Otto Baral
Re : Durella
This is a good addition!

I cannot see the link, could you tell me?
Ethan Crenson, 26-03-2022 21:45
Re : Durella
https://www.inaturalist.org/observations/20438540
Ethan Crenson, 26-03-2022 21:46
Re : Durella
The sequence I was given:

GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAATGAGAGCCGGTCCGCGTGGCGAGGTCTGAAAAACCCCACGTGCCAGTAAGTGACCGTAAACCTCCACCCGTGTGTATTATTCAATCGTTGCTTTGGCGGGCCGCGAGCCTCACAGGCTGGCACC GGCTTCGGCTGGGGAGTGCCTGCCAAGGGACCCAACTCTGTAATCTGTGGCCCTCTGAGTACTATACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAA CGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTAGACCACATCGCGCGAGCGGTATTGGGGCCTGCATGCTTGCATCCCTTAAAGACAGTGGCGGTGCCACGGGGCTCTCAGCGTAGTAATTCTTCCGCTGCTGGGCGCTGGAAGCACCTGCCAAAACCCCCCACCTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCA
Hans-Otto Baral, 26-03-2022 22:31
Hans-Otto Baral
Re : Durella
Ah, I did not have this sequence, although it is in GenBank.

It blasts not very close to the Boston sequence but is identical with it in the ITS, and also ERD 6117 is 100% identical.

The similarity to the amyloid macrospora is 92.3%.

So I was wrong in doubting this to be macrospora. And I do not know if the old type of macrospora was IKI+ or IKI-.