Accès membres

Mot de passe perdu? S'inscrire

22-07-2024 10:20

Hans-Otto Baral Hans-Otto Baral

Hello please note that I uploaded today an Englis

21-07-2024 10:13

Thierry Blondelle Thierry Blondelle

Bonjour,Récolte sur branchette de Castanea dans u

19-07-2024 10:24

Kozak Robert

Date: 2024.07.16Loess gorges, on soil with a lot o

21-07-2024 10:28

Alan Rockefeller Alan Rockefeller

Which Peziza did I find on horse dung in Humboldt

19-07-2024 11:08

Miguel Ãngel Ribes Miguel Ángel Ribes

Good morningThis Scutellinia from July 9 grew at 1

21-07-2024 06:23

Masanori Kutsuna

Dear all, Does anyone have these papers and send

08-07-2024 23:34

Villalonga Paco

Small Scutellinia growing in garden soil (calcareo

04-12-2020 18:23

Mirek Gryc

Hello allA friend sent me two collections of small

17-07-2024 11:33

Angel Pintos Angel Pintos

Hello, anybody body has:Pande A. and Rao, V.G. (1

16-07-2024 18:32

Andgelo Mombert Andgelo Mombert

Bonsoir, Un discomycète sur Liochlaena lanceolat

« < 1 2 3 4 5 > »
Durella
Ethan Crenson, 24-03-2022 20:43
As long as we are discussing Durella...!  I have found this Durella in New York City on several occasions.  It seems to grow on bare hardwood. I found it again last weekend in the Bronx, so the images and data are from that collection.

Apothecia are up to 1mm in diameter, brownish black, roughened and with a raised margin when dry. Cushion shaped when hydrated.


Spores (from spore drop) are hyaline, mostly 3-septate, some 4-septate, fusiform and some are a bit irregular shaped. Some spores are shorter, wider and tear-drop shaped.  Oil droplets are present.  They measure 14.7 - 27.9 (35.6) x 3.5-5.4µm.


Asci 68-87 x 8-11.1µm, no croziers, IKI-


Paraphyses branched, septate, brown at the ends and swollen up to 4-5µm wide.


In Zotto's folder for Durella, this seems to match "Durella macrospora IKI-". The spores in my collection are somewhat longer.  But I notice that they are similar in that the spores are quite irregularly shaped and some are quite small and tear drop shaped. 


Thanks,


Ethan

  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
Piotr Perz, 24-03-2022 20:58
Re : Durella
Are you sure about the croziers (image interpretation)?
IMO looks like CRZ+
Ethan Crenson, 24-03-2022 21:03
Re : Durella
(sigh) I'm often wrong about croziers.
Hans-Otto Baral, 24-03-2022 21:23
Hans-Otto Baral
Re : Durella
My first idea was also macrospora, but there the paraphysis tips do not carry browmn exudate and possess hyaline refractive resinous matter in the hymenium.

Patellariopsis clavispora is excluded by having a deep blue apical ring and globular excipular cells. I assume your sample has brown porrecta (please check).
Piotr Perz, 24-03-2022 21:24
Re : Durella
Try with young apothecium and very immature ascii.
Ethan Crenson, 26-03-2022 21:08
Re : Durella
Hello and thanks to you both.  First, yes, I missed the presence of croziers.  I include here a better photo.  As far as the exudate surrounding the paraphyses tips, I can't say for certain.  There is material there, but it doesn't look as if it is the same material which makes the paraphyses tips  brown. I have attempted to show the excipulum with textura porrecta.

There is a sequence of a collection very similar to this Durella (mislabeled D. melanochlora) which I found in a park in Staten Island (other end of the city) in 2019. Here is a link to the observation. The sequence is further down the page on the right. It blasts very close to another sequence that is labeled D. macrospora from the Boston Harbor Islands survey (Haelewaters,D., Dirks,A.C., Kappler,L.A., Mitchell,J.K., Quijada,L., Vandegrift,R., Buyck,B. and Pfister,D.H.)

Again, thanks!
  • message #72263
  • message #72263
  • message #72263
  • message #72263
  • message #72263
Hans-Otto Baral, 26-03-2022 21:24
Hans-Otto Baral
Re : Durella
This is a good addition!

I cannot see the link, could you tell me?
Ethan Crenson, 26-03-2022 21:45
Ethan Crenson, 26-03-2022 21:46
Re : Durella
The sequence I was given:

GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAATGAGAGCCGGTCCGCGTGGCGAGGTCTGAAAAACCCCACGTGCCAGTAAGTGACCGTAAACCTCCACCCGTGTGTATTATTCAATCGTTGCTTTGGCGGGCCGCGAGCCTCACAGGCTGGCACC GGCTTCGGCTGGGGAGTGCCTGCCAAGGGACCCAACTCTGTAATCTGTGGCCCTCTGAGTACTATACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAA CGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTAGACCACATCGCGCGAGCGGTATTGGGGCCTGCATGCTTGCATCCCTTAAAGACAGTGGCGGTGCCACGGGGCTCTCAGCGTAGTAATTCTTCCGCTGCTGGGCGCTGGAAGCACCTGCCAAAACCCCCCACCTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCA
Hans-Otto Baral, 26-03-2022 22:31
Hans-Otto Baral
Re : Durella
Ah, I did not have this sequence, although it is in GenBank.

It blasts not very close to the Boston sequence but is identical with it in the ITS, and also ERD 6117 is 100% identical.

The similarity to the amyloid macrospora is 92.3%.

So I was wrong in doubting this to be macrospora. And I do not know if the old type of macrospora was IKI+ or IKI-.