Accès membres

Mot de passe perdu? S'inscrire

15-07-2025 13:27

Angel Pintos Angel Pintos

Hello, does anyone have access to the following ar

14-07-2025 11:20

Michel Hairaud Michel Hairaud

Bonjour, Voici une espèce de  (?) Hyaloscyphace

16-01-2023 21:31

Riet van Oosten Riet van Oosten

Hello, Nearby the find of Calycina claroflava on

14-07-2025 17:55

Yanick BOULANGER

BonjourAutre dossier laissé en suspendJe viens de

14-07-2025 11:17

Yanick BOULANGER

BonjourJ'ai un dossier Jackrogersella qui est rest

14-07-2025 15:52

Gernot Friebes

Hi,I wanted to share this collection on Rubus idae

14-07-2025 13:37

Gernot Friebes

Hi,do you think this collection could be R. ulmari

25-02-2023 18:36

Elisabeth Stöckli

Bonsoir, Trouvé sur un tronc de Salix recouvert

12-07-2025 16:45

Thierry Blondelle Thierry Blondelle

Bonjour à tous,J'avais d'abord pensé à des stro

05-07-2025 12:38

Åge Oterhals

I found this pyrenomycetous fungi in pine forest o

« < 1 2 3 4 5 > »
Pezoloma marchantiae?
Georges Greiff, 08-12-2021 00:12
Hello all,
A couple of colleagues collected a whitish disco from living thalli of the liverwort Marchantia polymorpha (subsp. ruderalis). I think this is Pezoloma marchantiae.
Ascospores lacking guttules with dark spots near the ends (nuclei?). In water, n=20, averaging 8.65 x 4.3. Asci 8-spored, in IKI tips with a faint reddish band.

I have put some photos in the comments below. Please let me know if there is more information that would help to confirm the ID.

Thanks,
George

  • message #70992
Edouard Evangelisti, 08-12-2021 07:59
Edouard Evangelisti
Re : Pezoloma marchantiae?
Hello George,
In case thay may help, you can find here a paper on Pezoloma as well as a key. Sorry I don't get the original publication. I am curious, is this similar to the collection you are sending us in Cambridge?

Cheers,
Edouard
Georges Greiff, 08-12-2021 09:53
Re : Pezoloma marchantiae?
Hi Edouard,

Yes, it is the same. I am wanting to get external confirmation of the ID because P. marchantiae does not seem to have been recorded in the British Isles previously, whereas several people on here are famiiar with it from mainland Europe. Hope the specimen arrives safely!

Will add photos here shortly.

George
Georges Greiff, 08-12-2021 10:07
Re : Pezoloma marchantiae?
Some micrographs.
  • message #70995
  • message #70995
Enrique Rubio, 08-12-2021 11:20
Enrique Rubio
Re : Pezoloma marchantiae?
Georges Greiff, 08-12-2021 11:25
Re : Pezoloma marchantiae?
Thanks Erique,

I saw your great photos and I think our specimen agrees. The spore lengths I measured were slightly longer, on average, but some may have been overripe. It agrees with the measurements in Benkert 1981.
George
Enrique Rubio, 08-12-2021 11:33
Enrique Rubio
Re : Pezoloma marchantiae?
Sorry, I had called you Bernard instead of Georges.
Georges Greiff, 08-12-2021 12:06
Re : Pezoloma marchantiae?
Thanks Enrique. Would you be willing to agree with the ID here? I am not aware of any similar species on Marchantia.
Enrique Rubio, 08-12-2021 12:42
Enrique Rubio
Re : Pezoloma marchantiae?
Yes, I agree. There are not many similar species on Marchantiales.
Edouard Evangelisti, 08-12-2021 15:34
Edouard Evangelisti
Re : Pezoloma marchantiae?
Thanks, the samples arrived in excellent condition. I agree with the idea that there are little possibilities with that particular features on Marchantia polymorpha. I am running an ITS PCR anyway for confirmation. I will send you the sequence George.
  • message #71004
Georges Greiff, 08-12-2021 15:48
Re : Pezoloma marchantiae?
Fantastic to hear, Edouard, and looking forward to the sequence data.

I think that Jessica Nelson's recent (2018-) papers have published sequences of this in NCBI. Though they may not be labelled as P. marchantiae on there, I expect they will return as top BLAST hits.

Thanks and best wishes,
George
Edouard Evangelisti, 16-12-2021 17:44
Edouard Evangelisti
Re : Pezoloma marchantiae?
Hello Georges,

Please find the ITS sequence of your collection below.
I am going to submit it to NCBI. It would be great if you could send me the details of the collection (it was written on the samples but I am away from the lab right now) and the name of people involved in collection and identification, so they can get credit. The best hit is KY462822 from Zotto.

>P_marchantiae
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTATCCTTCCACGGA
AGCCTGTGTTCCCGCGACTCTAAATACAGGAGCAAGTAGCTAGAAGCTGC
TACATAATCGAACTGCGGGGATCTCCTAAAGCTCCGGCTACTCCCCTACC
GCTGAAAGGTGGTAGGCACAGTAAGAACGCCGGGGATGCGACAATGGACG
ATCCGCAGCCTAGCCCCTACCGTCGTTGACCACGGGGAAGGTTCACAGAC
TAAGTGATTATGGGTAGGGGTCCCCCCTACTTAAGATATAGTCGGTCGGT
TGGCGAGAGCTGACTGCTAGAGACGTTCCGTAGGTGAACCTGCGGAAGGA
TCACTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTTGAATACT
ATACCTTCGTTGCTTTGGCAGGCCGTGGAAACACCACCGACCCCGGCTAG
TGCGTGCCTGCCAGAGGAAACACAACTCTGTCTTTAGTGATGTCTGAGTA
CTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG
ATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT
GAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGG
CATGCCTGTTCGAGCGTCATTTCAACCAATCAAGCCTAGGCTTGGTCTTG
GGTTTGCGGTCTTTCGCACTCCCTAAACTTAGTGGCGGTGCGACTGAGCT
CTGAGCGTAGTAATTCTTCTCGCTATAGGGTCTTGGTCGTGACTTGCCAG
CAACCCCCTCTTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGC
TGAACTTAAGCATATCAATAAGCGGAGGA


Best wishes,
Edouard
Georges Greiff, 16-12-2021 17:57
Re : Pezoloma marchantiae?
Hi Edouard,

Great, thank you! Good to see that hits 2-4 (>99%) are Jessica Nelson's "Leotiomycetes sp. 1", which was also P. marchantiae collected from fruitbodies but not identified at the time. Nice to get confirmation.

I have attached a photo the collectors' details and the rest of the voucher information, including UK grid reference. Sorry it is a bit blurry. ID was suggested by me and supported by Enrique Rubio on here.

Thanks again and let me know if you need any other details.
George
  • message #71080
Hans-Otto Baral, 17-12-2021 10:07
Hans-Otto Baral
Re : Pezoloma marchantiae?
I am sorry I overlooked this thread. Great that a further sequence is available! I see only 1 nt difference in the ITS (ITS1) to Jean-Paul Priou's collection. A remark: There is an error in your sequence at the 3'-end of SSU: must be ATCATTA (you have ATCATA. If you send me the ab1 I will check it.

About nuclei: The central nucleus is only very faintly visible in the photos (in one spore of ERD 8970 and in one of my drawin HB 3445). The striking small dots at the spore ends are LBs.

Zotto
Edouard Evangelisti, 17-12-2021 16:53
Edouard Evangelisti
Re : Pezoloma marchantiae?
Hi Zotto,

Thanks for your message. Are you referring to the sequence within the ITS4 primer? My primer sequence is tcctccgcttattgatatgc (from White et al, 1990). This indeed gives ATCAATA. I attach the chromatogram.

Best wishes,
Edouard
  • message #71093
Hans-Otto Baral, 17-12-2021 21:58
Hans-Otto Baral
Re : Pezoloma marchantiae?
No, it is ATCATTA which is very close to the ITS1 primer. It is the highly constant end of SSU where the ITS1-region starts. Of course this is in forward direction as sequences are uploaded in GenBank.
Edouard Evangelisti, 18-12-2021 06:26
Edouard Evangelisti
Re : Pezoloma marchantiae?
Oh yes now I see, you mean the sequence ATCACTA in 5' should be ATCATTA. I think my chromatogram is clean there as well. Looks like a PCR mutation then.

Edouard
  • message #71098
Hans-Otto Baral, 18-12-2021 09:02
Hans-Otto Baral
Re : Pezoloma marchantiae?
Indeed!! In my files I see this mutation in one case only: MN047447 Gelatinopsis exidiophila
Edouard Evangelisti, 18-12-2021 16:27
Edouard Evangelisti
Re : Pezoloma marchantiae?
Good to know, in the future I will send two clones just in case.


Edouard