Accès membres

Mot de passe perdu? S'inscrire

25-01-2026 23:23

Tomaz Vucko Tomaz Vucko

Hello! I found this species that resembles Delitsc

06-02-2026 01:14

Tomaz Vucko Tomaz Vucko

Hello!How would you name this species? Most perith

04-08-2014 17:35

Leandro Sánchez Leandro Sánchez

Sur branche de feuillus, jusqu'à 22 mm diamètre,

05-02-2026 15:07

Vasileios Kaounas Vasileios Kaounas

Found on a fallen needle of Pinus halepensis, diam

05-02-2026 06:43

Stefan Blaser

Hello everybody, Any help on this one would be mu

18-08-2025 15:07

Lothar Krieglsteiner Lothar Krieglsteiner

.. 20.7.25, in subarctic habital. The liverwort i

02-02-2026 21:46

Margot en Geert Vullings

On a barkless poplar branch, we found hairy discs

02-02-2026 14:55

Andgelo Mombert Andgelo Mombert

Bonjour,Sur thalle de Lobaria pulmonaria.Conidiome

02-02-2026 14:33

Andgelo Mombert Andgelo Mombert

Bonjour,Sur le thalle de Peltigera praetextata, ne

31-01-2026 10:22

Michel Hairaud Michel Hairaud

Bonjour, Cette hypocreale parasite en nombre les

« < 1 2 3 4 5 > »
Ascomycet on old Peniophora quercina
Maren Kamke, 26-04-2021 20:38
Maren Kamke
Hello everybody,

I found this fungus with dark, encrusted, septate hairs, maybe of two kinds on Quercus twigs.

Asci 8-spored with croziers, IKI negative, spores ciborioid.

I'm glad about any help

Thanks

Maren
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
Enrique Rubio, 26-04-2021 20:58
Enrique Rubio
Re : Ascomycet on old Peniophora quercina
Hi Maren
Did you consider the possibility that it is a Dematioscypha? Are there any hyphomycete in the vicinity of the apothecia?
Hans-Otto Baral, 26-04-2021 21:00
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Hi Maren

do you have a photo of the hairs at higher resolution? I am not sure is it a Pyrenopeziza or a Hyphodiscus or ...?

Zotto
Maren Kamke, 26-04-2021 21:23
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Dear Enrique and Zotto,

I saw no Hyphomycetes around the Apothecia.

Here come two more pictures of the hairs and one with Baral'scher solution.

Maren
  • message #68642
  • message #68642
  • message #68642
Hans-Otto Baral, 26-04-2021 21:35
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Ah, these are discrete, not too dense warts! Funny, and not unlike Hyphodiiscus. Anyway I am unsure and cannot remember such a fungus. This definitely excludes a Pyrenopeziza.
Kosonen Timo, 27-04-2021 07:23
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
Hi Maren,

Do you do cultures & sequencing? This could well a member of the Hyphodiscus "family" as suggested. It would be interesting to place this one.

t. Timo
Maren Kamke, 27-04-2021 18:03
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Hi Timo,
unfortunately, as a amateurmycologist I don't do cultures and have only had one fungus sequenced so far, so I haven't any experience with it.
If you are interested, I can send you the fungus for this purpose.
Regards
Maren
Guy Marson, 28-04-2021 21:10
Re : Ascomycet on old Peniophora quercina
Hi Maren and Timo,
 
If you got material from Maren, and if your sequencing is successful, please let me know if it is this species or not:

>Hyphodiscus on Peniophora
ATCATTACCGAGCTCATGCCCTCCGGGGTAGACCTCCCACCCTT
GCTGATTTACCCGTTTGTTGCTTTGGCGGGCCGTCTTCATGGCC
ACCGGCGCCCGGCTGGTGCGCGCCCGCCAGAGACCCCCAAAA
CCCAGTCTGTTTACGTGTCCGTCCGAAACCCATATATAATATTAA
AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAAC
GCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAG
GGGCATGCCTGTCCGAGCGTCATAAACACCACTCAAGCTCCGC
TTGGTACTGGACCGTGCCGGCAACGGCAGGCCCCAAACTCAG
TGGCGGCGCCGCTAGGCTCCGAGCGTAGTACATTCCTCGCTCC
GGGGCCCCCGCGGTTGTCGACCAGCAACCCCCCTACTCTCAAG
TTTGACCT

I will load my sequence of such a species to GB when I have filled a gap of 300 nt in the LSU.

Best regards,

Guy
Kosonen Timo, 29-04-2021 11:12
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
allright. I'll let you know how it goes. ---trying not to draw too much conclusions from ITS seq, but maybe this Guy's sequence is of a non aff. Hyphodiscus species?? It deviates a lot from the median Hyphodiscus seqs. ...an Encoelia???

Timo