Accès membres

Mot de passe perdu? S'inscrire

16-11-2025 21:09

Robin Isaksson Robin Isaksson

Anyone recognize this acc. to pictures.? Found on

14-11-2025 16:26

Marian Jagers Marian Jagers

Hello everyone, On dead wood of Cytisus scoparius

15-11-2025 23:22

Mario Filippa

Hello,this is what I think to be Hymenoscyphus mac

15-11-2025 20:25

Riet van Oosten Riet van Oosten

Hello, Found by Laurens van der Linde, Nov. 2025

15-11-2025 09:21

Josep Torres Josep Torres

Hello.An anamorph resembling Capronia is sprouting

14-11-2025 18:31

Lothar Krieglsteiner Lothar Krieglsteiner

Hello,can somebody provide me with a file of:Rothe

12-11-2025 21:47

ruiz Jose

Hola a todos, me envían esta colección en resto

12-11-2025 09:25

Viktorie Halasu Viktorie Halasu

Hello, I need help with a pale terrestric Pseudom

11-11-2025 20:16

Bohan Jia

Hi, lastly I have found these tiny yellow decayin

09-11-2025 13:20

Josep Torres Josep Torres

Hello.A tiny ascomycete, appearing as erupting gra

« < 1 2 3 4 5 > »
Ascomycet on old Peniophora quercina
Maren Kamke, 26-04-2021 20:38
Maren Kamke
Hello everybody,

I found this fungus with dark, encrusted, septate hairs, maybe of two kinds on Quercus twigs.

Asci 8-spored with croziers, IKI negative, spores ciborioid.

I'm glad about any help

Thanks

Maren
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
Enrique Rubio, 26-04-2021 20:58
Enrique Rubio
Re : Ascomycet on old Peniophora quercina
Hi Maren
Did you consider the possibility that it is a Dematioscypha? Are there any hyphomycete in the vicinity of the apothecia?
Hans-Otto Baral, 26-04-2021 21:00
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Hi Maren

do you have a photo of the hairs at higher resolution? I am not sure is it a Pyrenopeziza or a Hyphodiscus or ...?

Zotto
Maren Kamke, 26-04-2021 21:23
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Dear Enrique and Zotto,

I saw no Hyphomycetes around the Apothecia.

Here come two more pictures of the hairs and one with Baral'scher solution.

Maren
  • message #68642
  • message #68642
  • message #68642
Hans-Otto Baral, 26-04-2021 21:35
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Ah, these are discrete, not too dense warts! Funny, and not unlike Hyphodiiscus. Anyway I am unsure and cannot remember such a fungus. This definitely excludes a Pyrenopeziza.
Kosonen Timo, 27-04-2021 07:23
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
Hi Maren,

Do you do cultures & sequencing? This could well a member of the Hyphodiscus "family" as suggested. It would be interesting to place this one.

t. Timo
Maren Kamke, 27-04-2021 18:03
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Hi Timo,
unfortunately, as a amateurmycologist I don't do cultures and have only had one fungus sequenced so far, so I haven't any experience with it.
If you are interested, I can send you the fungus for this purpose.
Regards
Maren
Guy Marson, 28-04-2021 21:10
Re : Ascomycet on old Peniophora quercina
Hi Maren and Timo,
 
If you got material from Maren, and if your sequencing is successful, please let me know if it is this species or not:

>Hyphodiscus on Peniophora
ATCATTACCGAGCTCATGCCCTCCGGGGTAGACCTCCCACCCTT
GCTGATTTACCCGTTTGTTGCTTTGGCGGGCCGTCTTCATGGCC
ACCGGCGCCCGGCTGGTGCGCGCCCGCCAGAGACCCCCAAAA
CCCAGTCTGTTTACGTGTCCGTCCGAAACCCATATATAATATTAA
AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAAC
GCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAG
GGGCATGCCTGTCCGAGCGTCATAAACACCACTCAAGCTCCGC
TTGGTACTGGACCGTGCCGGCAACGGCAGGCCCCAAACTCAG
TGGCGGCGCCGCTAGGCTCCGAGCGTAGTACATTCCTCGCTCC
GGGGCCCCCGCGGTTGTCGACCAGCAACCCCCCTACTCTCAAG
TTTGACCT

I will load my sequence of such a species to GB when I have filled a gap of 300 nt in the LSU.

Best regards,

Guy
Kosonen Timo, 29-04-2021 11:12
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
allright. I'll let you know how it goes. ---trying not to draw too much conclusions from ITS seq, but maybe this Guy's sequence is of a non aff. Hyphodiscus species?? It deviates a lot from the median Hyphodiscus seqs. ...an Encoelia???

Timo