Accès membres

Mot de passe perdu? S'inscrire

15-04-2025 21:39

Andreas Gminder Andreas Gminder

Dear all,struggeling as every year with the aquati

10-04-2025 10:09

Mathias Hass Mathias Hass

Hi, Found in March on last years stick from Rubus

09-04-2025 19:37

Miguel Ãngel Ribes Miguel Ángel Ribes

Good afternoon This 1-2 mm Mollisia was growing o

14-04-2025 23:19

Viktorie Halasu Viktorie Halasu

Hello, I've microscoped exsiccate of an Otidea wh

13-04-2025 17:23

Yanick BOULANGER

Bonjour à tousVoici un Lachnum que je n'arrive pa

13-04-2025 10:21

Castillo Joseba Castillo Joseba

Mer mandan el material de Galicia (España),  rec

13-04-2025 13:00

Zuzana Sochorová (Egertová) Zuzana Sochorová (Egertová)

Hello,I guess the best option how to label this co

10-04-2025 16:22

Bernard CLESSE Bernard CLESSE

Bonjour à toutes et tous,Pourriez-vous me confirm

12-04-2025 19:49

Andgelo Mombert Andgelo Mombert

Bonjour,Un ascomycète qui me pose problème.Ascom

10-04-2025 21:52

Andreas Millinger Andreas Millinger

Bonsoir! I'm new to the forum and would kindly as

« < 54 55 56 57 58 > »
Ascomycet on old Peniophora quercina
Maren Kamke, 26-04-2021 20:38
Maren Kamke
Hello everybody,

I found this fungus with dark, encrusted, septate hairs, maybe of two kinds on Quercus twigs.

Asci 8-spored with croziers, IKI negative, spores ciborioid.

I'm glad about any help

Thanks

Maren
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
  • message #68639
Enrique Rubio, 26-04-2021 20:58
Enrique Rubio
Re : Ascomycet on old Peniophora quercina
Hi Maren
Did you consider the possibility that it is a Dematioscypha? Are there any hyphomycete in the vicinity of the apothecia?
Hans-Otto Baral, 26-04-2021 21:00
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Hi Maren

do you have a photo of the hairs at higher resolution? I am not sure is it a Pyrenopeziza or a Hyphodiscus or ...?

Zotto
Maren Kamke, 26-04-2021 21:23
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Dear Enrique and Zotto,

I saw no Hyphomycetes around the Apothecia.

Here come two more pictures of the hairs and one with Baral'scher solution.

Maren
  • message #68642
  • message #68642
  • message #68642
Hans-Otto Baral, 26-04-2021 21:35
Hans-Otto Baral
Re : Ascomycet on old Peniophora quercina
Ah, these are discrete, not too dense warts! Funny, and not unlike Hyphodiiscus. Anyway I am unsure and cannot remember such a fungus. This definitely excludes a Pyrenopeziza.
Kosonen Timo, 27-04-2021 07:23
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
Hi Maren,

Do you do cultures & sequencing? This could well a member of the Hyphodiscus "family" as suggested. It would be interesting to place this one.

t. Timo
Maren Kamke, 27-04-2021 18:03
Maren Kamke
Re : Ascomycet on old Peniophora quercina
Hi Timo,
unfortunately, as a amateurmycologist I don't do cultures and have only had one fungus sequenced so far, so I haven't any experience with it.
If you are interested, I can send you the fungus for this purpose.
Regards
Maren
Guy Marson, 28-04-2021 21:10
Re : Ascomycet on old Peniophora quercina
Hi Maren and Timo,
 
If you got material from Maren, and if your sequencing is successful, please let me know if it is this species or not:

>Hyphodiscus on Peniophora
ATCATTACCGAGCTCATGCCCTCCGGGGTAGACCTCCCACCCTT
GCTGATTTACCCGTTTGTTGCTTTGGCGGGCCGTCTTCATGGCC
ACCGGCGCCCGGCTGGTGCGCGCCCGCCAGAGACCCCCAAAA
CCCAGTCTGTTTACGTGTCCGTCCGAAACCCATATATAATATTAA
AACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAAC
GCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTACTCCGAG
GGGCATGCCTGTCCGAGCGTCATAAACACCACTCAAGCTCCGC
TTGGTACTGGACCGTGCCGGCAACGGCAGGCCCCAAACTCAG
TGGCGGCGCCGCTAGGCTCCGAGCGTAGTACATTCCTCGCTCC
GGGGCCCCCGCGGTTGTCGACCAGCAACCCCCCTACTCTCAAG
TTTGACCT

I will load my sequence of such a species to GB when I have filled a gap of 300 nt in the LSU.

Best regards,

Guy
Kosonen Timo, 29-04-2021 11:12
Kosonen Timo
Re : Ascomycet on old Peniophora quercina
allright. I'll let you know how it goes. ---trying not to draw too much conclusions from ITS seq, but maybe this Guy's sequence is of a non aff. Hyphodiscus species?? It deviates a lot from the median Hyphodiscus seqs. ...an Encoelia???

Timo