Accès membres

Mot de passe perdu? S'inscrire

18-05-2026 12:43

Hymenoscyphus fraxineus
Sylvie Le Goff

Bonjour à tousPuis je avoir votre aide sur ce que

18-05-2026 10:13

Teleomorph of Botrytis cinerea?
Lieve Deceuninck Lieve Deceuninck

Dear forum members,I identified this as the teleom

17-05-2026 22:09

Mollisia sp
éric ROMERO éric ROMERO

Bonjour tous, Je sollicite vos avis pour ce Molli

17-05-2026 19:05

Coenogonium pineti
Thomas Flammer

I have found this tiny 200 ym cup shaped apothecia

17-05-2026 16:41

Lachnum
Margot en Geert Vullings

We found this Lachnum on an old Rubus stem.Fruitbo

05-04-2026 22:46

blue mould from Portugal
Lothar Krieglsteiner Lothar Krieglsteiner

on wood of Ceratonia, Algarve, 3.4.2026.The color

15-05-2026 13:33

Cistella geelmuydenii cf
Sylvie Le Goff

Bonjour à tousJe serais très reconnaissante enve

16-03-2011 14:31

Peziza cf ampelina
roman vargas alberto

Hi. I would like some opinion about this Peziza

14-05-2026 05:36

Lachnum subvirgineum (?)
Ethan Crenson

Hi all,  I haven't paid much attention to Lachnu

10-05-2026 23:17

Scleromitrula (?) from decaying leaves of Fagus/Acer
Andreas Gminder Andreas Gminder

Hello,today we found in a moist steep decidous for

« < 1 2 3 4 5 > »
Fracchiaea callista? on Carpinus
Ethan Crenson, 07-02-2023 22:28
Hello friends,

On Sunday, in the southern part of New York City, on a dead branch of Carpinus, a friend of mine found what I think might be Fracchiaea callista. In small patches, there are crowded clusters of collabent black fruiting bodies seated in a coarse brown subiculum. 

The asci are clavate and measure 76-90 x 13-16µm.  They contain about 32 spores --  I think!? It's very difficult to count them inside the ascus. I'd appreciate some opinions on the number of spores per ascus. (It's like guessing the number of jelly beans in a jar).

The spores are hyaline, allantoid and measure :

7.7-12.5 x 1.6-2.4µm

Me 9.3 x 2.2µm

Q=3.5-6.2

MeQ=4.3

N=23

Am I correct? Thanks for your help. 

Ethan
  • message #75131
  • message #75131
  • message #75131
  • message #75131
  • message #75131
  • message #75131
  • message #75131
  • message #75131
  • message #75131
  • message #75131
Jacques Fournier, 08-02-2023 15:37
Jacques Fournier
Re : Fracchiaea callista? on Carpinus
Hi Ethan,
this fungus is unknown to me, likely American, but I think you are close to the solution.
I went through 2010 Mugambi & Huhndorf's paper (Mycologia 102: 185-210) dealing with the phylogeny of Coronophorales and I learnt that F. callista has been moved to Neofracchieae callista, characterised by a brown subiculum, as on your photos.
I should display a quellkorper, visible in section or with some luck in a squash mount, which places it outside Nitschkiaceae in a distant family. Awful name, I don't even try to memorise it.
I could not find more information on this taxon, maybe Andy can help.

Cheers,
Jacques
Ethan Crenson, 08-02-2023 15:40
Re : Fracchiaea callista? on Carpinus
Greetings and thank you Jacques!  I must admit that, until I started researching this pyreno, I was completely unfamiliar with quellkorper or how to make one visible in a mount.  I will try. I did write to Dr. Miller directly, perhaps I will hear.

Ethan
Jacques Fournier, 08-02-2023 15:45
Jacques Fournier
Re : Fracchiaea callista? on Carpinus
it's a fairly big, gelatinous refractive obconical structure that does not stain in usual stains, sure you will spot it, if not on first attempt.
Good luck
Jacques
Ethan Crenson, 19-02-2026 17:50
Re : Fracchiaea callista? on Carpinus
I am returning to this post because I have an update, though not a solution.

I was never able to find a quellkörper after a few decent tries, so I decided to sequence this collection. I got what I believe is a decent ITS (below), but when I blast it, it does not match the one sequence of Neofracchiaea callista uploaded to GenBank by Huhndorf, Miller and Fernandez (AY695269).


The closest match is a distant 85.83% similarity to Yuxiensis granularis, which is in Scortechiniaceae (Coronophorales) and does bear a quellkörper.


I would not be surprised if my inability to find the quellkörper was due to my mediocre microscopy, inexperience, or not having a microtome. But I'm not certain.


Any ideas on this? I'd be very grateful for any at all.


Thanks!


ACAGAGTGCCCATGGCTCTGCCAACCCTGCGAACCTTACCATGTTGCCTCGGCGGCCTCAACCGCCGCAG
GCCCATCATACTCTTTTTATTACTATCGTCCCTCTGACTAAAACTTTTAATAAGTAAAAACTTTCAACAA
CGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTC
AGTGAACCATCGAGTCTTTGAACGCACATTGCGGCTGCCGGCATTCCGGCGGCCATGCCTGTCCGAGCGC
CACTAACACCCTCAGAGCCTAGTTTCTGGCGTTGGGTAACTGCCTCAGCGGCGGTCGCCTCAAAGTTAGT
GGCGGCGGCGCCCGTGGTGCGACGTACTCAGTAAAATTGCTAGCACGAAGCCCCGGCGCTCGCCTGCCGC
GAGAACCCCTCCATTTTAAAGTGGTTGGCCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATA

Adam Polhorský, 19-02-2026 19:12
Re : Fracchiaea callista? on Carpinus
Hi Ethan, the reason why this does not match is that ITS is generally not used in Coronophorales. Probably due the high intraspecific variability. You would need to sequence LSU (or RPB2, TEF)

A.
Ethan Crenson, 19-02-2026 19:13
Re : Fracchiaea callista? on Carpinus
Hi Adam,

Yes, that makes sense. 

Thanks for your reply!

Ethan