Hi Ethan,
this fungus is unknown to me, likely American, but I think you are close to the solution.
I went through 2010 Mugambi & Huhndorf's paper (Mycologia 102: 185-210) dealing with the phylogeny of Coronophorales and I learnt that F. callista has been moved to Neofracchieae callista, characterised by a brown subiculum, as on your photos.
I should display a quellkorper, visible in section or with some luck in a squash mount, which places it outside Nitschkiaceae in a distant family. Awful name, I don't even try to memorise it.
I could not find more information on this taxon, maybe Andy can help.

Cheers,
Jacques

it's a fairly big, gelatinous refractive obconical structure that does not stain in usual stains, sure you will spot it, if not on first attempt.
Good luck
Jacques

I am returning to this post because I have an update, though not a solution.

I was never able to find a quellkörper after a few decent tries, so I decided to sequence this collection. I got what I believe is a decent ITS (below), but when I blast it, it does not match the one sequence of Neofracchiaea callista uploaded to GenBank by Huhndorf, Miller and Fernandez (AY695269).

The closest match is a distant 85.83% similarity to Yuxiensis granularis, which is in Scortechiniaceae (Coronophorales) and does bear a quellkörper.

I would not be surprised if my inability to find the quellkörper was due to my mediocre microscopy, inexperience, or not having a microtome. But I'm not certain.

Any ideas on this? I'd be very grateful for any at all.

Thanks!

ACAGAGTGCCCATGGCTCTGCCAACCCTGCGAACCTTACCATGTTGCCTCGGCGGCCTCAACCGCCGCAG
GCCCATCATACTCTTTTTATTACTATCGTCCCTCTGACTAAAACTTTTAATAAGTAAAAACTTTCAACAA
CGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTC
AGTGAACCATCGAGTCTTTGAACGCACATTGCGGCTGCCGGCATTCCGGCGGCCATGCCTGTCCGAGCGC
CACTAACACCCTCAGAGCCTAGTTTCTGGCGTTGGGTAACTGCCTCAGCGGCGGTCGCCTCAAAGTTAGT
GGCGGCGGCGCCCGTGGTGCGACGTACTCAGTAAAATTGCTAGCACGAAGCCCCGGCGCTCGCCTGCCGC
GAGAACCCCTCCATTTTAAAGTGGTTGGCCTCGGATCAGGTAGGATTACCCGCTGAACTTAAGCATA