Accès membres

Mot de passe perdu? S'inscrire

24-03-2022 20:43

Durella
Ethan Crenson

As long as we are discussing Durella...!  I have

07-03-2022 21:31

Sarcoscypha parasite?
Malcolm Greaves Malcolm Greaves

A collegue came across a group of what turned out

25-03-2022 14:40

Literature search
Viktorie Halasu Viktorie Halasu

Hello forum,would anyone have p. 244 from Guarro e

24-03-2022 14:57

Tryblis arnoldii? No, Durella atrocyanea
Philipp Eschmann Philipp Eschmann

Hello everyoneI'm an amateur from Switzerland, thi

20-03-2022 21:20

Helvella bicolor (syn. ?H. albella) ????
Marek Capoun Marek Capoun

Hello everybody, can you help me with the confirma

22-03-2022 21:06

Helotiales on piece of board
Juuso Äikäs

Hello, today I found some tiny Helotiales growing

24-03-2022 09:42

Discomicete
Castillo Joseba Castillo Joseba

Me mandan el material seco de Galicia (España) re

22-03-2022 13:35

Nectriaceae ?
Castillo Joseba Castillo Joseba

Me mandan el material de Galicia (España),  reco

22-03-2022 13:15

young Xylaria cinerea? - from Portugal
Lothar Krieglsteiner Lothar Krieglsteiner

... Algarve near Monchique, on partly buried twigs

22-03-2022 13:05

ascomycete from Portugal
Lothar Krieglsteiner Lothar Krieglsteiner

collected 4.3.22 in the Algarve, Serra Monchique,

« < 264 265 266 267 268 > »
Durella
Ethan Crenson, 24-03-2022 20:43
As long as we are discussing Durella...!  I have found this Durella in New York City on several occasions.  It seems to grow on bare hardwood. I found it again last weekend in the Bronx, so the images and data are from that collection.

Apothecia are up to 1mm in diameter, brownish black, roughened and with a raised margin when dry. Cushion shaped when hydrated.


Spores (from spore drop) are hyaline, mostly 3-septate, some 4-septate, fusiform and some are a bit irregular shaped. Some spores are shorter, wider and tear-drop shaped.  Oil droplets are present.  They measure 14.7 - 27.9 (35.6) x 3.5-5.4µm.


Asci 68-87 x 8-11.1µm, no croziers, IKI-


Paraphyses branched, septate, brown at the ends and swollen up to 4-5µm wide.


In Zotto's folder for Durella, this seems to match "Durella macrospora IKI-". The spores in my collection are somewhat longer.  But I notice that they are similar in that the spores are quite irregularly shaped and some are quite small and tear drop shaped. 


Thanks,


Ethan

  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
  • message #72241
Piotr Perz, 24-03-2022 20:58
Re : Durella
Are you sure about the croziers (image interpretation)?
IMO looks like CRZ+
Ethan Crenson, 24-03-2022 21:03
Re : Durella
(sigh) I'm often wrong about croziers.
Hans-Otto Baral, 24-03-2022 21:23
Hans-Otto Baral
Re : Durella
My first idea was also macrospora, but there the paraphysis tips do not carry browmn exudate and possess hyaline refractive resinous matter in the hymenium.

Patellariopsis clavispora is excluded by having a deep blue apical ring and globular excipular cells. I assume your sample has brown porrecta (please check).
Piotr Perz, 24-03-2022 21:24
Re : Durella
Try with young apothecium and very immature ascii.
Ethan Crenson, 26-03-2022 21:08
Re : Durella
Hello and thanks to you both.  First, yes, I missed the presence of croziers.  I include here a better photo.  As far as the exudate surrounding the paraphyses tips, I can't say for certain.  There is material there, but it doesn't look as if it is the same material which makes the paraphyses tips  brown. I have attempted to show the excipulum with textura porrecta.

There is a sequence of a collection very similar to this Durella (mislabeled D. melanochlora) which I found in a park in Staten Island (other end of the city) in 2019. Here is a link to the observation. The sequence is further down the page on the right. It blasts very close to another sequence that is labeled D. macrospora from the Boston Harbor Islands survey (Haelewaters,D., Dirks,A.C., Kappler,L.A., Mitchell,J.K., Quijada,L., Vandegrift,R., Buyck,B. and Pfister,D.H.)

Again, thanks!
  • message #72263
  • message #72263
  • message #72263
  • message #72263
  • message #72263
Hans-Otto Baral, 26-03-2022 21:24
Hans-Otto Baral
Re : Durella
This is a good addition!

I cannot see the link, could you tell me?
Ethan Crenson, 26-03-2022 21:45
Re : Durella
https://www.inaturalist.org/observations/20438540
Ethan Crenson, 26-03-2022 21:46
Re : Durella
The sequence I was given:

GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAATGAGAGCCGGTCCGCGTGGCGAGGTCTGAAAAACCCCACGTGCCAGTAAGTGACCGTAAACCTCCACCCGTGTGTATTATTCAATCGTTGCTTTGGCGGGCCGCGAGCCTCACAGGCTGGCACC GGCTTCGGCTGGGGAGTGCCTGCCAAGGGACCCAACTCTGTAATCTGTGGCCCTCTGAGTACTATACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAA CGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTAGACCACATCGCGCGAGCGGTATTGGGGCCTGCATGCTTGCATCCCTTAAAGACAGTGGCGGTGCCACGGGGCTCTCAGCGTAGTAATTCTTCCGCTGCTGGGCGCTGGAAGCACCTGCCAAAACCCCCCACCTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCA
Hans-Otto Baral, 26-03-2022 22:31
Hans-Otto Baral
Re : Durella
Ah, I did not have this sequence, although it is in GenBank.

It blasts not very close to the Boston sequence but is identical with it in the ITS, and also ERD 6117 is 100% identical.

The similarity to the amyloid macrospora is 92.3%.

So I was wrong in doubting this to be macrospora. And I do not know if the old type of macrospora was IKI+ or IKI-.